Welcome, Guest. Please Login
YaBB - Yet another Bulletin Board
 
  HomeHelpSearchLogin  
 
error during NielsenYang.bf (Read 1501 times)
Paasei
YaBB Newbies
*
Offline


Feed your monkey!

Posts: 4
error during NielsenYang.bf
Oct 19th, 2010 at 6:06am
 
I just started using HyPhy for dN/dS calculations. I did a number of runs using the quickselectiondetection.bf (SLAC) without a problem. However, if I run NielsenYang or the dNdSrateanalysis, I always get the same kind of error messages (see attach). Any idea would could be the problem ?
Back to top
 
 
IP Logged
 
Sergei
YaBB Administrator
*****
Offline


Datamonkeys are forever...

Posts: 1658
UCSD
Gender: male
Re: error during NielsenYang.bf
Reply #1 - Oct 19th, 2010 at 5:57pm
 
Hi there,

I can't see to recreate the problem. Could you provide more information to help me identify the cause:

1). Which version of HyPhy are you using?
2). Which analysis options did you select before the error popped up?

Sergei

Paasei wrote on Oct 19th, 2010 at 6:06am:
I just started using HyPhy for dN/dS calculations. I did a number of runs using the quickselectiondetection.bf (SLAC) without a problem. However, if I run NielsenYang or the dNdSrateanalysis, I always get the same kind of error messages (see attach). Any idea would could be the problem ?

Back to top
 

Associate Professor
Division of Infectious Diseases
Division of Biomedical Informatics
School of Medicine
University of California San Diego
WWW WWW  
IP Logged
 
Paasei
YaBB Newbies
*
Offline


Feed your monkey!

Posts: 4
Re: error during NielsenYang.bf
Reply #2 - Oct 21st, 2010 at 12:45am
 
Hi,
I use the win32 GUI version 2.0.

I specified these options :
- run all distributions
- MG94 3x4 custom, specifying 012230
- cutoff 0.95
- 3 categories in distribution

Thanks !
Back to top
 
 
IP Logged
 
Sergei
YaBB Administrator
*****
Offline


Datamonkeys are forever...

Posts: 1658
UCSD
Gender: male
Re: error during NielsenYang.bf
Reply #3 - Oct 21st, 2010 at 6:29pm
 
Hi there,

Sorry, I can't replicate the issue. Can you possibly attach your alignment file to see if I can find the issue using it?

Sergei
Back to top
 

Associate Professor
Division of Infectious Diseases
Division of Biomedical Informatics
School of Medicine
University of California San Diego
WWW WWW  
IP Logged
 
Paasei
YaBB Newbies
*
Offline


Feed your monkey!

Posts: 4
Re: error during NielsenYang.bf
Reply #4 - Oct 25th, 2010 at 5:10am
 
I have narrowed down the error, I do not get it while running the single rate model, only when doing the others (neutral and selection).
The input are 635 nucleotide sequences (but I also get the error with less sequences):
>K03455
CCTCAGGTCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGA
AGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTT
>A04321
CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGA
AGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTT
>A07867
CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGA
AGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTT
>AB078005
CCTCAAATCACTCTTTGGCAACGACCCCTCGTTACAATAAAGGTAGGGGGGCAACTAAAG
GAAGCTCTGTTAGACACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGA
AGATGGAAACCGAAAATGATAGGGGGAATTGGAGGTTTTATTAAAGTAAGACAGTATGAT
CAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTGGTAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTT
>AB097870
CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAATTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGGATTTGCCAGGA
AGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGATACCCATAGAAATCTGTGGACACAAAGCTATAGGTACAGTATTAGTAGGACCAACA
CCTGTCAACATAATTGGAAGAAATCTGCTGACTCAGGTTGGTTGCACTTTAAATTTT
>AB221005
CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGA
AGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAATAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTT
>AB221125
CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAGTAAAAATAGGGGGACAGCTAAAG
GAAGCTCTGTTAGATACAGGGGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGA
AGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGGTACCCATAGAAATCTGTGAACATAAAGTTATAGGTACAGTATTAATAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGCTGCACTTTAAATTTT
>AB221126
CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAGTAAAAATAGGGGGACAGCTAAAG
GAAGCTCTGTTAGATACAGGGGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGA
AGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGGTACCCATAGAAATCTGTGAACATAAAGTTATAGGTACAGTATTAATAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGCTGCACTTTAAATTTT
>AB253432
CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGA
AGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAATAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTT
>AB286955
CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGGTAGGGGGACAGCTAAAA
GAGGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATAAATTTGCCAGGA
AGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGATACTCGTAGAAATCTGTGGACATAAAGCTATAGGTACAGTCTTAGTAGGACCTACA
CCTGTCAACATAATTGGAAGAAACCTGTTGACTCAGATTGGCTGCACTTTAAATTTT
>AB286956
CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGGTAGGGGGACAGCTAAAA
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATAAATTTGCCAGGA
AGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGATACTCGTAGAAATCTGTGGACATAAAGCTATAGGTACAGTCTTAGTAGGACCTACA
CCTGTCAACATAATTGGAAGAAACCTGTTGACTCAGATTGGCTGCACTTTAAATTTT
>AB287363
CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGA
AAATGGAAACCAAAAATGATAGGAGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGATACCCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAATAGGACCTACA
CCCGTCAACATAATTGGAAGAAATTTGTTGACGCAGCTTGGGTGTACTTTAAATTTT
>AB287364
CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGGTAGGGGGACAGCTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATAGATTTACCAGGA
AGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGATACTAGTAGAAATTTGTGGACATAGAGCTATAGGTACAGTATTAGTAGGACCTACA
CCTGTTAACATAATTGGAAGAAATCTGTTGACTCAGATTGGCTGCACTTTAAATTTT
>AB287365
CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGGTAGGGGGACAGCTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATAGATTTACCAGGA
AGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGATACTAGTAGAAATTTGTGGACATAGAGCTATAGGTACAGTATTAGTAGGACCTACA
CCTGTTAACATAATTGGAAGAAATCTGTTGACTCAGATTGGCTGCACTTTAAATTTT
>AB287366
CCTCAGATCACTCTTTGGCAGCGACCCCTCGTCACAATAAGGATAGGAGGGCAGCTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCGGGA
AGATGGAAACCGAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGATACCCATAGAAATCTGTGGAAAGAAAACTATAGGTACAGTATTAATAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGATGCACTTTAAATTTT
>AB287367
CCTCAGATCACTCTTTGGCAGCGACCCCTCGTCACAATAAGGATAGGAGGGCAGCTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCGGGA
AGATGGAAACCGAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGATACCCATAGAAATCTGTGGAAAGAAAACTATAGGTACAGTATTAATAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGATGCACTTTAAATTTT
>AB287368
CCTCAGATCACTCTTTGGCAACGACCCCTTGTCACAGTAAAGGTAGGGGGGCAACTAAGG
GAAGCCCTATTAGATACAGGAGCAGATGATACAGTGTTAGAAGAAATGAATTTGCCAGGA
AAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAAATACCTGTAGACATCTGTGGTCATAAAGCTGTAGGTACAGTGTTAATAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGGTGCACTTTAAATTTT
>AB287369
CCTCAAATCACTCTTTGGCAACGACCCATCGTCACAATAAAGATAGGGGGGCAACTAAAA
GAGGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGA
AGATGGAAACCAAAAATGATAGTGGGAATTGGAGGTTTTGTCAAAGTAAGACAGTATGAT
CAGGTACCCATAGAAATCTGTGGGCATAAAATTGAAGGTACAGTGTTAATAGGACCTACC
CCTGCCAACATAATTGGAAGAAATCTGATGACTCAGCTTGGTTGCACTTTAAATTTT
>AB287370
CCTCAAATCACTCTTTGGCAACGACCCATCGTCACAATAAAGATAGGGGGGCAACTAAAA
GAGGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGA
AGATGGAAACCAAAAATGATAGTGGGAATTGGAGGTTTTGTCAAAGTAAGACAGTATGAT
CAGGTACCCATAGAAATCTGTGGGCATAAAATTGAAGGTACAGTGTTAATAGGACCTACC
CCTGCCAACATAATTGGAAGAAATCTGATGACTCAGCTTGGTTGCACTTTAAATTTT
>AB287371
CCTCAAATCACTCTTTGGCAACGACCCATCGTCACAGTAAAGATAGGGGGGCAACTAAAA
GAGGCTATATTAGATACAGGAGCAGATAATACAGTATTAGAAGACATGAATTTGCCAGGA
AGATGGACACCAAAAATAATAGGAGGAATTGGAGGTTTTGTCAAAGTAAGACAGTATGAT
CAGGTACCCATAGAAATCTGTGGGCACAAAACTGAAGGTACAGTATTAATAGGACCTACA
CCTGTCAACATAATTGGAAGAGATCTGATGACTCAGCTTGGTTTCACTTTAAATTTT
>AB287372
CCTCAAATCACTCTTTGGCAACGACCCATCGTCACAGTAAAGATAGGGGGGCAACTAAAA
GAGGCTATATTAGATACAGGAGCAGATAATACAGTATTAGAAGACATGAATTTGCCAGGA
AGATGGACACCAAAAATAATAGGAGGAATTGGAGGTTTTGTCAAAGTAAGACAGTATGAT
CAGGTACCCATAGAAATCTGTGGGCACAAAACTGAAGGTACAGTATTAATAGGACCTACA
CCTGTCAACATAATTGGAAGAGATCTGATGACTCAGCTTGGTTTCACTTTAAATTTT
>AB289587
CCTCAGATCACTCTTTGGCAACGACCCATCGTCACAATAAAGATAGGGGGGCAACTGAGG
GAAGCTCTATTGGATACAGGAGCAGATGATACAGTGTTAGAAGAAATAAATTTGCCAGGA
AAATGGAAACCAAAAATAATAGGGGGAATTGGAGGTCTTATCAAAGTAAGACAGTATGAT
AATATACCCATAGAAATCTGTGGACATAAAGTTATAGGTTCAGTATTAGTAGGACCTACA
CCTACCAACATAATTGGAAGAAGTCTGATGACTCAACTTGGTTGCACTTTAAATTTT
>AB289588
CCTCAGATCACTCTTTGGCAACGACCCATCGTCACAATAAAGATAGGGGGGCAACTGAGG
GAAGCTCTATTGGATACAGGAGCAGATGATACAGTGTTAGAAGAAATAAATTTGCCAGGA
AAATGGAAACCAAAAATAATAGGGGGAATTGGAGGTCTTATCAAAGTAAGACAGTATGAT
AATATACCCATAGAAATCTGTGGACATAAAGTTATAGGTTCAGTATTAGTAGGACCTACA
CCTACCAACATAATTGGAAGAAGTCTGATGACTCAACTTGGTTGCACTTTAAATTTT
>AB289589
CCTCAGATCACTCTTTGGCAACGACCCATCGTCACAATAAAGATAGGGGGGCAGCTAAAG
GAAGCACTATTAGATACAGGAGCAGATAATACAGTATTAGAAGAAATGAATTTGCCAGGA
AGATGGAAACCAAAAATAATAGGGGGAATTGGAGGTTTTCTCAAAGTAAGACAGTATGAT
CAGATACCCATAGAAATCTGTGGACATAAAACTATAGGTACAGTATTAGTAGGACCTACA
CCTGTCAACGTAGTTGGAAGGGATCTGATGACTCAGCTTGGTTGCACTTTAAATTTT
>AB289590
CCTCAGATCACTCTTTGGCAACGACCCATCGTCACAATAAAGATAGGGGGGCAGCTAAAG
GAAGCACTATTAGATACAGGAGCAGATAATACAGTATTAGAAGAAATGAATTTGCCAGGA
AGATGGAAACCAAAAATAATAGGGGGAATTGGAGGTTTTCTCAAAGTAAGACAGTATGAT
CAGATACCCATAGAAATCTGTGGACATAAAACTATAGGTACAGTATTAGTAGGACCTACA
CCTGTCAACGTAGTTGGAAGGGATCTGATGACTCAGCTTGGTTGCACTTTAAATTTT
>AB428551
CCTCAGATCACTCTTTGGCAACGACCCCTCGTCCCAATAAAGATAGGGGGGCAACTAAAG
GAAGCCCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGA
AAATGGAAACCAAAAATAATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGGTACCCGTAGAAATCTGCGGACATAAAGCTATAGGTGCAGTATTAGTAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTT
>AB428552
CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGA
AAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAA
CAGGTACCCATAGAAATCTGCGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGATGACTCAGCTTGGGTGCACTTTAAATTTT
>AB428553
CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGA
AAATGGAAACCAAAAATAATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGGTAACCGTAGAAATCTGCGGACATAAAGCTATAGGTGCAGTATTAATAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTT
>AB428554
CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAA
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGA
AAATGGAAACCAAAAATAATAGGGGGAATTGGAGGCTTTATCAAAGTAAGACAGTATGAT
CAGGTAACCGTAGAAATCTGCGGACATAAAGCTATAGGTGCAGTATTAATAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTT
>AB428555
CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGA
AAATGGAAACCAAAAATAATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGGTACCCATAGAAATCTGCGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACA
CCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTT
Back to top
 
 
IP Logged
 
Sergei
YaBB Administrator
*****
Offline


Datamonkeys are forever...

Posts: 1658
UCSD
Gender: male
Re: error during NielsenYang.bf
Reply #5 - Oct 25th, 2010 at 12:11pm
 
Dear Paasei,

Could you attach the alignment file (and the tree that comes with it), instead of pasting the sequences in as text.

Sergei
Back to top
 

Associate Professor
Division of Infectious Diseases
Division of Biomedical Informatics
School of Medicine
University of California San Diego
WWW WWW  
IP Logged
 
Paasei
YaBB Newbies
*
Offline


Feed your monkey!

Posts: 4
Re: error during NielsenYang.bf
Reply #6 - Oct 25th, 2010 at 12:15pm
 
Sergei wrote on Oct 25th, 2010 at 12:11pm:
Dear Paasei,

Could you attach the alignment file (and the tree that comes with it), instead of pasting the sequences in as text.

Sergei

I'll try the zip-file.

Another thing, I get the error on my laptop and on my desktop at work, however, it works fine on my desktop at home, so there seems to be a computerspecific error ? (Windows version ? )
Back to top
 
Multimedia File Viewing and Clickable Links are available for Registered Members only!!  You need to Login Login (18 KB | )
 
IP Logged